ID: 976246767_976246777

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 976246767 976246777
Species Human (GRCh38) Human (GRCh38)
Location 4:83012708-83012730 4:83012741-83012763
Sequence CCCGCGCAGGCACTCGCAGCGGG CCCTTCCCGCCAGCCCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 0, 2: 2, 3: 41, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!