ID: 976246767_976246788

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 976246767 976246788
Species Human (GRCh38) Human (GRCh38)
Location 4:83012708-83012730 4:83012758-83012780
Sequence CCCGCGCAGGCACTCGCAGCGGG CCCAGGAGCCCCCATCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 0, 2: 3, 3: 26, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!