ID: 976282052_976282067

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 976282052 976282067
Species Human (GRCh38) Human (GRCh38)
Location 4:83335062-83335084 4:83335104-83335126
Sequence CCACTTGAAGGGTGCGGAGATGG GAGGCCTGGGGAGGAGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 121} {0: 1, 1: 0, 2: 8, 3: 76, 4: 561}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
19 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG - 4:83335104-83335126 GAGGCCTGGGGAGGAGCGCCCGG +
33 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG - 4:83335118-83335140 AGCGCCCGGGGAGGAGCGCCCGG +