ID: 976282052_976282068

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 976282052 976282068
Species Human (GRCh38) Human (GRCh38)
Location 4:83335062-83335084 4:83335105-83335127
Sequence CCACTTGAAGGGTGCGGAGATGG AGGCCTGGGGAGGAGCGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 121} {0: 1, 1: 0, 2: 2, 3: 63, 4: 706}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
34 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG - 4:83335119-83335141 GCGCCCGGGGAGGAGCGCCCGGG +
20 4:83335062-83335084 CCACTTGAAGGGTGCGGAGATGG - 4:83335105-83335127 AGGCCTGGGGAGGAGCGCCCGGG +