ID: 976291831_976291834

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 976291831 976291834
Species Human (GRCh38) Human (GRCh38)
Location 4:83426723-83426745 4:83426736-83426758
Sequence CCAACTAATTTCTGTATTCTTTT GTATTCTTTTAGAAGAGACGGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 405, 3: 5594, 4: 25509} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!