|
Left Crispr |
Right Crispr |
| Crispr ID |
976306530 |
976306544 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:83565646-83565668
|
4:83565694-83565716
|
| Sequence |
CCATCATGCCAGGCTAATTTTTG |
CCCGGTGGGTACCCCGAGTCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 110, 1: 3863, 2: 40568, 3: 119482, 4: 199091} |
{0: 1, 1: 2, 2: 17, 3: 18, 4: 64} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|