ID: 976360673_976360680

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 976360673 976360680
Species Human (GRCh38) Human (GRCh38)
Location 4:84174478-84174500 4:84174529-84174551
Sequence CCATCTCAAAAAAAAAAAAAAAA AGGTCAAATGGAATCAAAGCAGG
Strand - +
Off-target summary {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!