ID: 976393065_976393069

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 976393065 976393069
Species Human (GRCh38) Human (GRCh38)
Location 4:84525685-84525707 4:84525702-84525724
Sequence CCCCGTCTTAACTAAACATACAG ATACAGAAAAAAGATTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 84, 3: 5086, 4: 118754} {0: 1, 1: 14, 2: 460, 3: 2312, 4: 12991}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!