|
Left Crispr |
Right Crispr |
| Crispr ID |
976393065 |
976393071 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:84525685-84525707
|
4:84525710-84525732
|
| Sequence |
CCCCGTCTTAACTAAACATACAG |
AAAAGATTAGCTGGGCATGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 84, 3: 5086, 4: 118754} |
{0: 113, 1: 13810, 2: 70956, 3: 145817, 4: 202682} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|