ID: 976393065_976393072

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 976393065 976393072
Species Human (GRCh38) Human (GRCh38)
Location 4:84525685-84525707 4:84525713-84525735
Sequence CCCCGTCTTAACTAAACATACAG AGATTAGCTGGGCATGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 84, 3: 5086, 4: 118754} {0: 45, 1: 8911, 2: 27762, 3: 53284, 4: 59047}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!