ID: 976409735_976409744

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 976409735 976409744
Species Human (GRCh38) Human (GRCh38)
Location 4:84699728-84699750 4:84699758-84699780
Sequence CCCCCACCCCATTATGGTCATCC TATGAAGTGGTATCTCATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137} {0: 69, 1: 607, 2: 2780, 3: 20115, 4: 16086}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!