ID: 976409738_976409742

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 976409738 976409742
Species Human (GRCh38) Human (GRCh38)
Location 4:84699731-84699753 4:84699745-84699767
Sequence CCACCCCATTATGGTCATCCTAG TCATCCTAGTAAATATGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} {0: 1, 1: 0, 2: 29, 3: 141, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!