ID: 976413768_976413776

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 976413768 976413776
Species Human (GRCh38) Human (GRCh38)
Location 4:84747605-84747627 4:84747623-84747645
Sequence CCCATAATCCCCACAAGTCATGA CATGAGAGGGACACAGTGGAAGG
Strand - +
Off-target summary {0: 2, 1: 44, 2: 469, 3: 1430, 4: 3409} {0: 2, 1: 10, 2: 119, 3: 963, 4: 1936}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!