ID: 976441902_976441904

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 976441902 976441904
Species Human (GRCh38) Human (GRCh38)
Location 4:85085547-85085569 4:85085563-85085585
Sequence CCACTGTCTGTCTGGTTTCCTGA TTCCTGAGTTGCTCTTTATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 391} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!