ID: 976445425_976445430

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 976445425 976445430
Species Human (GRCh38) Human (GRCh38)
Location 4:85125656-85125678 4:85125696-85125718
Sequence CCCTTTTCTGTTTTCTGCATCAG GCACAGATGTATGCAGCAACAGG
Strand - +
Off-target summary {0: 4, 1: 20, 2: 29, 3: 460, 4: 3555} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!