ID: 976475212_976475218

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 976475212 976475218
Species Human (GRCh38) Human (GRCh38)
Location 4:85475388-85475410 4:85475429-85475451
Sequence CCCGCGCTGCGGAGCAGCCCAGT CCCCTTGTTGTGGAAAGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131} {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!