ID: 976478719_976478722

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 976478719 976478722
Species Human (GRCh38) Human (GRCh38)
Location 4:85514143-85514165 4:85514161-85514183
Sequence CCAGACTCCATCTTTCTATTCTA TTCTAAGGATTATTCACCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 365} {0: 2, 1: 0, 2: 0, 3: 14, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!