ID: 976492986_976492992

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 976492986 976492992
Species Human (GRCh38) Human (GRCh38)
Location 4:85693519-85693541 4:85693543-85693565
Sequence CCCTGGGGCACAGGGACCTGCTG TGGCTCCATCCTGTGTACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 369} {0: 1, 1: 0, 2: 0, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!