ID: 976499420_976499425

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 976499420 976499425
Species Human (GRCh38) Human (GRCh38)
Location 4:85770363-85770385 4:85770416-85770438
Sequence CCAATGCTTTCTCACCTAAGAAA TAAATGTCTCCCTACTTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 312} {0: 1, 1: 0, 2: 2, 3: 21, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!