ID: 976499423_976499428

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 976499423 976499428
Species Human (GRCh38) Human (GRCh38)
Location 4:85770397-85770419 4:85770429-85770451
Sequence CCTCCTATTGTTCACAAAATAAA ACTTCCTAGGTTTGTTTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 311} {0: 1, 1: 1, 2: 4, 3: 67, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!