ID: 976502336_976502341

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 976502336 976502341
Species Human (GRCh38) Human (GRCh38)
Location 4:85806049-85806071 4:85806076-85806098
Sequence CCTACCCCATTCAGCTGCTTCAT CCAGATTTTCAAAGCTTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 245} {0: 1, 1: 0, 2: 2, 3: 29, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!