ID: 976515221_976515229

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 976515221 976515229
Species Human (GRCh38) Human (GRCh38)
Location 4:85956758-85956780 4:85956792-85956814
Sequence CCGACACCCAGCCAGGGTGGAAG CAGCAAAAAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 261} {0: 1, 1: 33, 2: 92, 3: 149, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!