ID: 976540443_976540447

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 976540443 976540447
Species Human (GRCh38) Human (GRCh38)
Location 4:86268289-86268311 4:86268341-86268363
Sequence CCATCTTCTCACCATCTTTACTG TTCACCTGAATTCTTGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 495} {0: 1, 1: 0, 2: 1, 3: 24, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!