ID: 976571541_976571552

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 976571541 976571552
Species Human (GRCh38) Human (GRCh38)
Location 4:86617566-86617588 4:86617608-86617630
Sequence CCCTCCCCCTTCCCCTTCCAGCA TTAATGATCGCCATTCTAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 202, 4: 1721} {0: 5197, 1: 15176, 2: 5986, 3: 5036, 4: 6665}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!