|
Left Crispr |
Right Crispr |
| Crispr ID |
976571541 |
976571554 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:86617566-86617588
|
4:86617618-86617640
|
| Sequence |
CCCTCCCCCTTCCCCTTCCAGCA |
CCATTCTAACTGGTGTGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 13, 3: 202, 4: 1721} |
{0: 13371, 1: 7321, 2: 6736, 3: 5195, 4: 3433} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|