ID: 976598289_976598296

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 976598289 976598296
Species Human (GRCh38) Human (GRCh38)
Location 4:86914701-86914723 4:86914751-86914773
Sequence CCGTTCTTCTTATAGATGTGCAC CTGGGTATGATCCCTGTTCCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 14, 4: 184} {0: 1, 1: 2, 2: 2, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!