ID: 976608674_976608684

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 976608674 976608684
Species Human (GRCh38) Human (GRCh38)
Location 4:87007017-87007039 4:87007051-87007073
Sequence CCGCGTTGTGCTGTTGCTGGGCA CCGGCGGTCTTCGAGCGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!