ID: 976628042_976628050

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 976628042 976628050
Species Human (GRCh38) Human (GRCh38)
Location 4:87207825-87207847 4:87207876-87207898
Sequence CCATCTGGAAAAACCTGCCAAAT GACATCGGAGGGCCCCCTCAAGG
Strand - +
Off-target summary {0: 8, 1: 13, 2: 10, 3: 61, 4: 442} {0: 1, 1: 2, 2: 5, 3: 10, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!