ID: 976708502_976708506

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 976708502 976708506
Species Human (GRCh38) Human (GRCh38)
Location 4:88043479-88043501 4:88043498-88043520
Sequence CCCTCCTATTTCTGTGTGGTTGT TTGTACATACATCCTATTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 403} {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!