ID: 976723383_976723389

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 976723383 976723389
Species Human (GRCh38) Human (GRCh38)
Location 4:88192406-88192428 4:88192443-88192465
Sequence CCTTTTCCCTTTCTTTTCCTTTT TCGCTCCATCGCCCAGGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 14, 3: 91, 4: 795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!