ID: 976756628_976756633

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 976756628 976756633
Species Human (GRCh38) Human (GRCh38)
Location 4:88505336-88505358 4:88505386-88505408
Sequence CCTGGCTCTCTCTCCTTATTCTC TAACTCCATGACACCTCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 603} {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!