ID: 976762743_976762751

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 976762743 976762751
Species Human (GRCh38) Human (GRCh38)
Location 4:88568304-88568326 4:88568345-88568367
Sequence CCAAGGGCTCTTCAGTTAGCAGG TTCTGTCCTTCTCTTCATGGTGG
Strand - +
Off-target summary {0: 96, 1: 235, 2: 436, 3: 749, 4: 1261} {0: 1, 1: 0, 2: 14, 3: 107, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!