ID: 976789814_976789819

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 976789814 976789819
Species Human (GRCh38) Human (GRCh38)
Location 4:88865763-88865785 4:88865790-88865812
Sequence CCTACAAAACTACTGACAAAAAT GGTACGCGGGATTTGGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 561} {0: 1, 1: 0, 2: 5, 3: 32, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!