ID: 976794388_976794400

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 976794388 976794400
Species Human (GRCh38) Human (GRCh38)
Location 4:88916089-88916111 4:88916139-88916161
Sequence CCCCCTAACTATGTGATGCCCTG CAGATATAGCACCTTGAGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 36, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!