ID: 976794488_976794495

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 976794488 976794495
Species Human (GRCh38) Human (GRCh38)
Location 4:88917285-88917307 4:88917333-88917355
Sequence CCAGGCTCTTTTTAATAACCAGC ACTCACTCACTTCCAAGGGAGGG
Strand - +
Off-target summary {0: 8, 1: 158, 2: 465, 3: 746, 4: 1019} {0: 1, 1: 3, 2: 17, 3: 59, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!