ID: 976802492_976802506

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 976802492 976802506
Species Human (GRCh38) Human (GRCh38)
Location 4:89008238-89008260 4:89008289-89008311
Sequence CCTAGCCCCCAATGTGCCCACAG GAAGGTTAAATGAGGCCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 375} {0: 1, 1: 2, 2: 66, 3: 318, 4: 900}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!