ID: 976839597_976839604

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 976839597 976839604
Species Human (GRCh38) Human (GRCh38)
Location 4:89416383-89416405 4:89416427-89416449
Sequence CCTACATGAGTCTTTCATGAGGC TTTCTGGCCAGCCTTATTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!