ID: 976899120_976899121

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 976899120 976899121
Species Human (GRCh38) Human (GRCh38)
Location 4:90152317-90152339 4:90152339-90152361
Sequence CCTTGATTGGTGTGTGTAGGTTA AAAAATTTGCCCTTAACCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100} {0: 1, 1: 0, 2: 3, 3: 19, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!