ID: 976959788_976959791

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 976959788 976959791
Species Human (GRCh38) Human (GRCh38)
Location 4:90956230-90956252 4:90956251-90956273
Sequence CCTACAGAAGCATTATTATACAG AGTGGTTTCAGGTCAGATTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!