|
Left Crispr |
Right Crispr |
| Crispr ID |
976962973 |
976962979 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:91002365-91002387
|
4:91002409-91002431
|
| Sequence |
CCCTTCTTCCTCAGGAATACCAG |
TAACGTAGTCCCAAACTTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 8, 3: 45, 4: 304} |
{0: 1, 1: 61, 2: 230, 3: 779, 4: 7262} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|