ID: 976978757_976978763

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 976978757 976978763
Species Human (GRCh38) Human (GRCh38)
Location 4:91197236-91197258 4:91197276-91197298
Sequence CCTTGCTTTCTCCCCATATAAGG CTTATGTGAATATATCTAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 195} {0: 1, 1: 0, 2: 1, 3: 19, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!