ID: 976979681_976979683

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 976979681 976979683
Species Human (GRCh38) Human (GRCh38)
Location 4:91211853-91211875 4:91211887-91211909
Sequence CCTCCAAAGATCTCTAACAAACT TATTAGTTTAAAAAAATTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 204} {0: 1, 1: 0, 2: 10, 3: 140, 4: 1413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!