ID: 976989959_976989962

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 976989959 976989962
Species Human (GRCh38) Human (GRCh38)
Location 4:91353856-91353878 4:91353883-91353905
Sequence CCAATTTCCAAACATGGCTACAG GCATCTGTGCCACACTTGCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 40, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!