ID: 977000460_977000464

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 977000460 977000464
Species Human (GRCh38) Human (GRCh38)
Location 4:91492380-91492402 4:91492428-91492450
Sequence CCAAAAAAACTACAATTGTATAA AAGCACTGCTGTCTCTTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 579} {0: 1, 1: 0, 2: 0, 3: 35, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!