|
Left Crispr |
Right Crispr |
| Crispr ID |
977004463 |
977004466 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:91547530-91547552
|
4:91547561-91547583
|
| Sequence |
CCTTCTTCCTTCTGTTTACTTTT |
TGTGCCTTCATATTTAAAATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 19, 3: 201, 4: 2049} |
{0: 1, 1: 7, 2: 32, 3: 181, 4: 909} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|