ID: 977060707_977060712

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 977060707 977060712
Species Human (GRCh38) Human (GRCh38)
Location 4:92254530-92254552 4:92254548-92254570
Sequence CCACTTAACAAAGCACTCTGGCT TGGCTGTCCCTTTGTGGAGGGGG
Strand - +
Off-target summary {0: 17, 1: 21, 2: 42, 3: 158, 4: 432} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!