ID: 977071673_977071681

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 977071673 977071681
Species Human (GRCh38) Human (GRCh38)
Location 4:92397890-92397912 4:92397941-92397963
Sequence CCATCACTATACCTACTCCAAGT TTGCAAATTTGTGTTCACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118} {0: 1, 1: 0, 2: 0, 3: 28, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!