ID: 977071675_977071681

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 977071675 977071681
Species Human (GRCh38) Human (GRCh38)
Location 4:92397901-92397923 4:92397941-92397963
Sequence CCTACTCCAAGTTAATGTGGCCT TTGCAAATTTGTGTTCACACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 28, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!