ID: 977073341_977073344

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 977073341 977073344
Species Human (GRCh38) Human (GRCh38)
Location 4:92421344-92421366 4:92421368-92421390
Sequence CCTTATACAATTGTGGGAGGAGC GAGGAAATACAGATGGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 18, 4: 98} {0: 1, 1: 1, 2: 4, 3: 75, 4: 834}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!