ID: 977132459_977132462

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 977132459 977132462
Species Human (GRCh38) Human (GRCh38)
Location 4:93258939-93258961 4:93258970-93258992
Sequence CCCAGGTGAGGAATATTAATAAG TGCTGACTAGAGTACCACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 301} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!